Page 197
Page 197
A familiar feeling surfaced in my consciousness.
This time, it wasn't a string of words, but a string of random letters.
“AACATGAAGGTTTTGGCCAA…”
This string of letters is frighteningly long!
Fang Jing was stunned for a moment, and a long string of letters, overwhelming and overwhelming, flew through his mind.
I rely on!
Haven't reacted yet.
"Shh-"
In reality, Fang Jing suddenly opened his eyes.
The first thing you see is soft lighting.
Even though Fang Jing hadn't seen the light for a long time, it wasn't glaring at all; everything was just right!
"So, you fainted because it triggered something?"
Seeing that Fang Jing had woken up, Zhou Yuan handed Fang Jing a nutritional maintenance solution.
"That's right, the prompt has appeared, but I'm a little confused about it."
Fang Jing scratched his head; such a long string of letters.
What exactly is this thing?!
and many more.
ATCG?!
Fang Jing pondered for a moment.
The entire densely packed alphabet consists of only these four letters.
It's a letter, if he remembers correctly.
These are base pairs in DNA!
Adenine (A), cytosine (C), guanine (G), thymine (T)!
This, this, this!
The biological knowledge he had learned flashed through Fang Jing's mind quickly.
Therefore,
That machine gave Fang Jing a string of gene sequence information.
"Is its purpose to make me find this gene sequence?"
Fang Jing frowned deeply.
He had some basic ideas.
This gene sequence should be the core of the new world.
"Brother Zhou, I think I understand now. When are we going back to Earth?"
Fang Jing suddenly clapped his hands, he understood, he understood everything.
He's going back to Earth right now!
"Rest for two days, then we'll go into hibernation immediately."
Seeing his anxious expression, Zhou Yuan smiled slightly and said:
"Don't rush, you've just finished your hibernation, so you need to take care of your health."
"it is good!"
Fang Jing was already quite impatient to return to Earth.
He wanted to see it.
What exactly is this string of genetic data that has been read?
Chapter 156 The Origin of Life!
Jupiter Gravity.
After consulting with the scientists on board the ship, Fang Jing learned...
The next hibernation will be in fifteen days.
This scientifically determined interval, based on a "dormant database," aims to avoid adverse effects of medication on the body.
"Take this time to explore the spaceship."
Zhang Changchu smiled and led the two of them to their destination, explaining:
"We have reached Jupiter's orbit. You can look at Jupiter through the panoramic observation window."
"It's magnificent, countless times more awe-inspiring than Earth!"
The captain was telling the truth.
Parking in Jupiter's orbit gives you a completely different feeling than parking in Earth's orbit.
The azure Earth has a dreamlike quality.
The massive planet Jupiter, on the other hand, brings an endless sense of oppression!
"it is good."
Fang Jing's mind was completely focused on that string of letters, and he was somewhat absent-minded at the moment.
The two rested for two days aboard the Jupiter Gravity, following the captain.
During this period, the spacecraft conducted a variety of complex scientific experiments.
This includes the detection of the composition of Jupiter's atmosphere, the specific counting of the number of Jupiter's moons, and the specific study of the planet's internal environment.
"Of the 107 satellites, several are nestled in Jupiter's dark regions, which previous probes had not even counted!"
This is the biggest scientific discovery of the past two days.
Jupiter has 107 moons!
This is 15 more than the original 92 observed by astronomical observation.
The astrophysicists on board the spacecraft, after confirming this number, had eyes that practically glowed green.
I'll risk my life to come to Jupiter with this ship.
It was definitely the right decision.
A little discovery here.
For astronomy, this is a groundbreaking advancement!
The number of satellites is just an appetizer; almost all researchers, whether consciously or unconsciously, have focused their attention on Europa.
Europa, discovered by Galileo in 1610, has a diameter of 3100 kilometers, which is smaller than the Moon.
The satellite has a thin atmosphere containing oxygen, and its outer layer is covered by an ice layer up to 100 kilometers thick, beneath which there may be a world of liquid water.
This satellite was once called by humans as the last planet in the solar system, besides Earth, that might contain life!
It is because of this information,
Now, the Jupiter Gravity probe has arrived in Jupiter's orbit, and the mystery of Europa is right before our eyes!
All the accompanying experts and scholars had their own thoughts.
If it can be confirmed that life exists on Europa.
Even the most primitive archaea would undoubtedly be hailed as "one of the greatest discoveries of the world"!
For the scientists present, reputation was secondary.
The key is.
Capable of studying extraterrestrial life!
"Captain Zhang is here!"
Zhang Xu, an extraterrestrial life scientist who was organizing experimental procedures, was immediately excited when he saw Zhang Changchu passing by.
"Oh, it's Professor Zhang. What can I do for you?"
Upon hearing someone call his name, Zhang Changchu, who was leading the team for Fang Jing and Zhou Yuan, immediately stopped and asked in a low voice.
"Captain, when do we begin our exploration of Europa?!"
Zhang Xu's voice was somewhat excited.
"Oh, that's what I was just about to say."
Seeing Professor Zhang Xu's excited expression, Zhang Changchu chuckled and explained:
"The basic exploration mission has been completed, and we are now preparing the lander."
aircannonsinc